DNA sequence sanitization
GBIF sanitizes the raw DNA/RNA sequences published in occurrence records before they are indexed and made searchable. The goal is to produce a normalised, comparable sequence together with a set of quality metrics, while keeping every transformation transparent and reproducible.
Each occurrence sequence is passed through a fixed, ordered pipeline. The original raw sequence is never altered in the source data — only a cleaned copy is derived for indexing. The cleaned sequence is hashed (MD5) to produce a stable nucleotideSequenceID used to group identical sequences across records.
Pipeline stages
The pipeline applies the following stages in order. Each stage takes the output of the previous stage as its input.
| Stage | Description | Example |
|---|---|---|
Normalise whitespace and case |
All whitespace characters are removed, and the sequence is upper-cased. If any whitespace was present, this is recorded and contributes to the |
|
Detect natural language |
The sequence is checked for configured marker words (for example primer or read-merging labels). A match flags the record but does not modify the sequence (see Sequence flags and validity. |
|
Remove gaps |
Characters matching the gap pattern ( |
|
RNA to DNA conversion |
RNA sequences are normalised to DNA by replacing every |
|
Question marks to N |
Question marks, sometimes used to denote an unknown base, are replaced with the IUPAC ambiguity code |
|
Trim to anchors |
Leading and trailing characters are removed until a run of valid nucleotide "anchor" characters is found at each end.
If either end is trimmed (or the sequence is set to an empty string), |
|
Cap N-runs |
Long stretches of |
|
Quality metrics
All metrics are calculated on the final cleaned sequence.
| Field | Type | Description |
|---|---|---|
|
string |
The final cleaned sequence. Set to |
|
integer |
Length of the cleaned sequence in bytes. |
|
float |
Fraction of characters that are not valid IUPAC DNA codes. |
|
float |
Fraction of characters that are ambiguous IUPAC codes (anything other than A, C, G, T or N). |
|
float |
Fraction of characters that are |
|
integer |
Number of N-runs that were shortened in the last stage. |
|
float |
GC content, calculated over A/C/G/T bases only. |
|
boolean |
Whether natural-language marker words were found. |
|
boolean |
Whether either end of the sequence was trimmed. |
|
boolean |
Whether any whitespace or gap characters were removed. |
|
string |
MD5 hash of the final cleaned sequence, used for indexing and grouping. |
|
boolean |
Whether the record is considered invalid (see below). |
The fraction metrics are null when the cleaned sequence is empty, and gcContent is null when the sequence contains no A/C/G/T bases.
|
Sequence flags and validity
Sanitization records a set of flags describing what happened during cleaning, for example, whether the ends were trimmed or gaps removed, and whether the result is usable. A sequence is flagged invalid when, after cleaning, it still contains characters that are not valid IUPAC DNA codes (nonIupacFraction > 0) or when natural language is detected. Invalid sequences are not indexed: both sequence and nucleotideSequenceID are set to null, while the quality metrics are still reported so the reason can be inspected.
The individual flags and their definitions are documented alongside GBIF’s other occurrence flags — see Sequence issues.
Configuration
The pipeline is driven by a small set of configuration parameters, allowing the thresholds and character sets to be tuned without changing the logic.
anchor_chars: "ACGTU" # Valid anchor characters used when trimming ends
anchor_minrun: 8 # Minimum consecutive anchors required to define an end
gap_regex: "[-\\.]" # Characters removed as gaps
natural_language_regex: "REVERSE|REV|FWD|FORWARD|MERGED|UNMERGED" # Marker words
iupac_rna: "ACGTURYSWKMBDHVN" # Valid IUPAC RNA codes
iupac_dna: "ACGTRYSWKMBDHVN" # Valid IUPAC DNA codes (used for nonIupacFraction)
nrun_cap_from: 6 # Cap N-runs of this length or longer
nrun_cap_to: 5 # ...down to this length
Example
Given the raw input "ACGT-ACGT NNNNNNNNNN ACGT" the sanitization stages are as follows:
-
Whitespace is removed →
"ACGT-ACGTNNNNNNNNNNACGT" -
Gaps are removed →
"ACGTACGTNNNNNNNNNNACGT" -
No
Uor?are detected, and the sequence is left unchanged -
Anchor runs are detected at both ends, and the sequence is left unchanged
-
Caps the run of ten
Ndown to five →"ACGTACGTNNNNNACGT"
The result has sequenceLength 17, gcContent 0.5, nRunsCapped 1, and gapsOrWhitespaceRemoved true.
Example API response
The sanitized sequence and its metrics are delivered through the GBIF occurrence API as a nucleotideSequence array on each occurrence record. The array can also be used as a search filter, for example nucleotideSequence.invalid=false to return only records with at least one valid sequence.
"nucleotideSequence": [
{
"nucleotideSequenceID": "a3ebee35f7fc2883cf68b22c9e9f6ca4",
"targetGene": "COI",
"sequence": "CGTTATATTTTTTATTAGGGAGATGATCTGCGATAATAGGGACGGCTATGAGAGTTTTAATTCGGGTGGAGTTGGGGAGAACGGGAAGATTAATCGGGGATGATCATTTATATAATGTTGTTGTGACTGCTCATGCTTTAGTGATGATTTTTTTTATAGTTATGCCTATCTTAATTGGGGGATTTGGAAATTGGCTGGTTCCTTTAATATTGGGTGCACCGGATATAGCTTTTCCTCGTATGAATAACTTAAGATTTTGGTTATTACCTTTTTCAATAATGTTGTTGTTAATGTCTTCTATAATTGAGACAGGAGTGGGGGCAGGGTGGACTATTTATCCGCCTTTAGCCGGGTTGGAGGGGCATGGAGGAGTAAGTATGGATTTAGCGATTTTTTCATTACACTTGGCTGGGGCTTCATCTATTATGGGGGCTATTAATTTTATTTGTACTATTTTAAACATACGAATAGAGGGAATGACTTTAGATAAGATTCCTTTGTTTGTTTGGTCAGTGCTTATTACTGCAGTCTTATTGTTATTGTCATTACCAGTATTGGCGGGGGCTATTACTATACTTTTGACTGATCGTAATTTTAATACATCTTTTTTTGATCCGGCAGGTGGAGGAGATCCTGTGTTGTTTCAACATTTATT",
"sequenceLength": 655,
"gcContent": 0.37251908396946565,
"nonIupacFraction": 0.0,
"nonACGTNFraction": 0.0,
"nFraction": 0.0,
"nRunsCapped": 0,
"naturalLanguageDetected": false,
"endsTrimmed": false,
"gapsOrWhitespaceRemoved": false,
"invalid": false
}
]
The targetGene field is not produced by the sanitization pipeline. It is the interpreted value of the publisher-supplied target gene, normalised against the GBIF target gene vocabulary (API). All other fields are as described above.
|